Search

Genetic Disease Webquest - Teacher's Section

Introduction

Teacher’s Introduction and Instructions for use in a Classroom

This webquest, designed for high school and undergraduate students, is an ideal introduction to the concepts of bioinformatics, genetic diseases, and potential careers in science fields. The activity can be used in conjunction with a visit to the Koshland Science Museum’s exhibit: “Infectious Disease: Evolving Challenges to Human Health,” or as a stand-alone lesson.

The webquest is easily adaptable to fit the needs of your classroom. It is recommended that students be divided up into groups of four, so that each student can assume the role of one of the medical investigation team members. This encourages cooperative learning in the student groups and also gives students a chance to work as a team, much the way a real-world investigative team might do. Alternatively, the webquest can be completed by students individually, investigating all four roles on their own. Either way, emphasis should be placed on students communicating their findings by creating a presentation, using multimedia tools whenever possible.

This webquest is designed to take approximately one week. However, it is also possible to shorten the activity to one class period by completing only the bioinformatics section

Background - Background information on the cystic fibrosis gene.
Flowchart and worksheets - Graphical flowchart of student activities and corresponding worksheets.
Science Education Standards - The National Science Education Standards relevant to this activity.
Evaluation - Rubric for evaluating student acheivement
Alternative Activities - Other suggestion of activities you can do in your classroom related to this webquest.

Background

Background Information for Teachers

This webquest focuses on the genetically inherited disease cystic fibrosis. It is a recessive disease that is characterized by gastrointestinal and respiratory problems such as coughing, pneumonia, and bronchitis. If untreated, many children die before their first birthday. With treatment, the median age of survival is the low 30s.

Below is the entire mRNA sequence for the CFTR gene (mutations of which cause cystic fibrosis). The mutation discussed in the webquest is in underlined bold text.

>gi|6995995|ref|NM_000492.2| Homo sapiens cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7) (CFTR), mRNA
AATTGGAAGCAAATGACATCACAGCAGGTCAGAGAAAAAGGGTTGAGCGGCAGGCACCCAGAGT
AGTAGGTCTTTGGCATTAGGAGCTTGAGCCCAGACGGCCCTAGCAGGGACCCCAGCGCCCGAGA
GACCATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTCTCCAAACTTTTTTTCAGCTGGACCA
GACCAATTTTGAGGAAAGGATACAGACAGCGCCTGGAATTGTCAGACATATACCAAATCCCTTCT
GTTGATTCTGCTGACAATCTATCTGAAAAATTGGAAAGAGAATGGGATAGAGAGCTGGCTTCAAAG
AAAAATCCTAAACTCATTAATGCCCTTCGGCGATGTTTTTTCTGGAGATTTATGTTCTATGGAATCTT
TTTATATTTAGGGGAAGTCACCAAAGCAGTACAGCCTCTCTTACTGGGAAGAATCATAGCTTCCTAT
GACCCGGATAACAAGGAGGAACGCTCTATCGCGATTTATCTAGGCATAGGCTTATGCCTTCTCTTTA
TTGTGAGGACACTGCTCCTACACCCAGCCATTTTTGGCCTTCATCACATTGGAATGCAGATGAGAAT
AGCTATGTTTAGTTTGATTTATAAGAAGACTTTAAAGCTGTCAAGCCGTGTTCTAGATAAAATAAGTAT
TGGACAACTTGTTAGTCTCCTTTCCAACAACCTGAACAAATTTGATGAAGGACTTGCATTGGCACAT
TTCGTGTGGATCGCTCCTTTGCAAGTGGCACTCCTCATGGGGCTAATCTGGGAGTTGTTACAGGCG
TCTGCCTTCTGTGGACTTGGTTTCCTGATAGTCCTTGCCCTTTTTCAGGCTGGGCTAGGGAGAATG
ATGATGAAGTACAGAGATCAGAGAGCTGGGAAGATCAGTGAAAGACTTGTGATTACCTCAGAAAT
GATTGAAAATATCCAATCTGTTAAGGCATACTGCTGGGAAGAAGCAATGGAAAAAATGATTGAAAA
CTTAAGACAAACAGAACTGAAACTGACTCGGAAGGCAGCCTATGTGAGATACTTCAATAGCTCAG
CCTTCTTCTTCTCAGGGTTCTTTGTGGTGTTTTTATCTGTGCTTCCCTATGCACTAATCAAAGGAAT
CATCCTCCGGAAAATATTCACCACCATCTCATTCTGCATTGTTCTGCGCATGGCGGTCACTCG
GCAATTTCCCTGGGCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGAT
TTCTTACAAAAGCAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGA
GAATGTAACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAA
CAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCC
TGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTG
GAGCAGGCAAGACTTCACTTCTAATGATGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATT
AAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAA
AATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAAAGCATGCCAACTA
GAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGGAGAAGGTGGAATCACACT
GAGTGGAGGTCAACGAGCAAGAATTTCTTTAGCAAGAGCAGTATACAAAGATGCTGATTTGTATTT
ATTAGACTCTCCTTTTGGATACCTAGATGTTTTAACAGAAAAAGAAATATTTGAAAGCTGTGTCTGT
AAACTGATGGCTAACAAAACTAGGATTTTGGTCACTTCTAAAATGGAACATTTAAAGAAAGCTGAC
AAAATATTAATTTTGAATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAAATCTAC
AGCCAGACTTTAGCTCAAAACTCATGGGATGTGATTCTTTCGACCAATTTAGTGCAGAAAGAAGAA
ATTCAATCCTAACTGAGACCTTACACCGTTTCTCATTAGAAGGAGATGCTCCTGTCTCCTGGACAG
AAACAAAAAAACAATCTTTTAAACAGACTGGAGAGTTTGGGGAAAAAAGGAAGAATTCTATTCTCAA
TCCAATCAACTCTATACGAAAATTTTCCATTGTGCAAAAGACTCCCTTACAAATGAATGGCATCGAA
GAG GATTCTGATGAGCCTTTAGAGAGAAGGCTGTCCTTAGTACCAGATTCTGAGCAGGGAGAGGC
GATACTGC CTCGCATCAGCGTGATCAGCACTGGCCCCACGCTTCAGGCACGAAGGAGGCAGTCT
GTCCTGAACCTGATGACACACTCAGTTAACCAAGGTCAGAACATTCACCGAAAGACAACAGCATC
CACACGAAAAGTGTCACTGGCCCCTCAGGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTT
ATCTCAAGAAACTGGCTTGGAAATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCCTTTTT
GATGATATGGAGAGCATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCAC
AAGAGCTTAATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTT
GTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAATAACA
GCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTACGTGGGAGTAGCCGA
CACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCATACTCTAATCACAGTGTCGAAA
ATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCACCTATGTCAACCCTCAACACGTTGAAAG
CAGGTGGGATTCTTAATAGATTCTCCAAAGATATAGCAATTTT GGATGACCTTCTGCCTCTTACC
ATATTTGACTTCATCCAGTTGTTATTAATTGTGATTGGAGCTATAGCAGTTGTCGCAGTTTTACAACC
CTACATCTTTGTTGCAACAGTGCCAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAA
CCTCACAGCAACTCAAACAACTGGAATCTGAAGGCAGGAGTCCAATTTTCAC TCATCTTGTTACA
AGCTTAAAAGGACTATGGACACTTCGTGCCTTCGGACGGCAGCCTTACTTTGAAACTCTGTTCCAC
AAAGCTCTGAATTTACATACTGCCAACTGGTTCTTGTACCTGTCAACACTGCGCTGGTTCCAAATGA
GAATAGAAATGATTTTTGTCATCTTCTTCATTGCTGTTACCTTCATTTCCATTTTAACAACAGGAGAA
GGAGAAGGAAGAGTTGGTATTATCCTGACTTTAGCCATGAATATCATGAGTACATTGCAGTGGGCT
GTAAACTCCAGCATAGATGTGGATAGCTTGATGCGATCTGTGAGCCGAGTCTTTAAGTTCATTGA
CATGCCAACAGAAGGTAAACCTACCAAGTCAACCAAACCATACAAGAATGGCCAACTCTCGAAAG
TTATGATTATTGAGAATTCACACGTGAAGAAAGATGACATCTGGCCCTCAGGGGGCCAAATGACTGT
CAAAGATCTCACAGCAAAATACACAGAAGGTGGAAATGCCATATTAGAGAACATTTCCTTCTCAAT
AAGTCCTGGCCAGAGGGTGGGCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAG
CTTTTTTGAGACTACTGAACACTGAAGGAGAAATCCAGATCGATGGTGTGTCTTGGGATTCAATAAC
TTTGCAACAGTGGAGGAAAGCCTTTGGAGTGATACCACAGAAAGTATTTATTTTTTCTGGAACATTT
AGAAAAAACTTGGATCCCTATGAACAGTGGAGTGATCAAGAAATATGGAAAGTTGCAGATGAGGTT
GGGCTCAGATCTGTGATAGAACAGTTTCCTGGGAAGCTTGACTTTGTCCTTGTGGATGGGGGCTG
TGTCCTAAGCCATGGCCACAAGCAGTTGATGTGCTTGGCTAGATCTGTTCTCAGTAAGGCGAAGA
TCTTGCTGCTTGATGAACCCAGTGCTCATTTGGATCCAGTAACATACCAAATAATTAGAAGAACT
CTAAAACAAGCATTTGCTGATTGCACAGTAATTCTCTGTGAACACAGGATAGAAGCAATGCTGGA
ATGCCAACAATTTTTGGTCATAGAAGAGAACAAAGTGCGGCAGTACGATTCCATCCAGAAACTGC
TGAACGAGAGGAGCCTCTTCCGGCAAGCCATCAGCCCCTCCGACAGGGTGAAGCTCTTTCCCC
ACCGGAACTCAAGCAAGTGCAAGTCTAAGCCCCAGATTGCTGCTCTGAAAGAGGAGACAGAAGA
AGAGGTGCAAGATACAAGGCTTTAGAGAGCAGCATAAATGTTGACATGGGACATTTGCTCATGGA
ATTGG AGCTCGTGGGACAGTCACCTCATGGAATTGGAGCTCGTGGAACAGTTACCTCTGCCTCA
GAAAACAAGGA TGAATTAAGTTTTTTTTTAAAAAAGAAACATTTGGTAAGGGGAATTGAGGACACT
GATATGGGTCTTGAT AAATGGCTTCCTGGCAATAGTCAAATTGTGTGAAAGGTACTTCAAATCCT
TGAAGATTTACCACTTGTGT TTTGCAAGCCAGATTTTCCTGAAAACCCTTGCCATGTGCTAGTAA
TTGGAAAGGCAGCTCTAAATGTCAA TCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCG
TTAATTTGTAGTGTTGGAGAAGAACTGAAATC ATACTTCTTAGGGTTATGATTAAGTAATGATAAC
TGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCTTTTTCTCTCCTCTCCCCATGATGTTTAG
AAACACAACTATATTGTTTGCTAAGCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAATA
CCACAGGAACCACAAGACTGCACATCAAAATATGCCCCATTCAACATCT AGTGAGCAGTCA
GGAAAGAGAACTTCCAGATCCTGGAAATCAGGGTTAGTATTGTCCAGGTCTACCAAAA ATCT
CAATATTTCAGATAATCACAATACATCCCTTACCTGGGAAAGGGCTGTTATAATCTTTCACAGG
GG ACAGGATGGTTCCCTTGATGAAGAAGTTGATATGCCTTTTCCCAACTCCAGAAAGTGACAA
GCTCACAGACCTTTGAACTAGAGTTTAGCTGGAAAAGTATGTTAGTGCAAATTGTCACAGGACA
GCCCTTCTTTCCACAGAAGCTCCAGGTAGAGGGTGTGTAAGTAGATAGGCCATGGGCACTGT
GGGTAGACACACATGAAGTCCAAGCATTTAGATGTATAGGTTGATGGTGGTATGTTTTCAGGCT
AGATGTATGTACTTCATGCTGTCTACACTAAGAGAGAATGAGAGACACACTGAAGAAGCACCAA
TCATGAATTAGTTTTATATGCTTCTGTTTTATAATTTTGTGAAGCAAAATTTTTTCTCTAGGAAATA
TTTATTTTAATAATGTTTCAAACATATATTACAATGCTGTATTTTAAAAGAATGATTATGAATTACA
TTTGTATAAAATAATTTTTATATTTGAAATATTGACTTTTTATGGCACTAGTATTTTTATGAAATATT
ATGTTAAAACTGGGACAGGGGAGAACCTAGGGTGATATTAACCAGGGGCCATGAATCACCTTTT
GGTCTGGAGGGAAGCCTTGGGGCTGATCGAGTTGTTGCCCACAGCTGTATGATTCCCAGCCA
GACACAGCCTCTTAGATGCAGTTCTGAAGAAGATGGTACCACCAGTCTGACTGTTTCCATCAA
GGGTACACTGCCTTCTCAACTCCAAACTGACTCTTAAGAAGACTGCATTATATTTATTACTGTA
AGAAAATATCACTTGTCAATAAAATCCATACATTTGTGT

Worksheets

Flowchart and Worksheets

The following worksheets are used in this webquest.

Group worksheet

Individual worksheets
Disease Specialist
DNA Researcher
Genetic Counselor
Epidemiologist

Science Standards

Science Standards

This webquest will address the following National Science Education Standards for grades 9 - 12.

Content Standard A – Science as Inquiry
“All students should develop understandings about scientific inquiry.”
“Think critically and logically to make the relationships between evidence and explanations”

Using evidence and logical thinking, students develop an understanding of the DNA sequence as the universal language of all living systems. This commonality allows for the use of model organisms in scientific inquiry to gain knowledge about how life works. Students see how DNA sequence technology will affect their lives as individuals susceptible to genetic diseases.

Content Standard B – Physical Science
“All students should develop an understanding of chemical reactions.”

Students enhance their understanding of chemical reactions and atomic structure by looking more deeply at the structure and function of DNA. Students see how chemical reactions enable forensic scientists to use DNA sequences as a tool to identify criminals and to exonerate individuals who are falsely accused.

Content Standard C – Life Science
“All students should develop an understanding of the cell and of the molecular basis of heredity.”

Students strengthen their understanding of the molecular basis of heredity, the chemical basis of life, and the impact of mutations on living systems. The webquest also provides an opportunity to study ways in which scientists have used an understanding of DNA sequences to solve problems in society.

Content Standard E – Science and Technology
“All students should develop understandings about science and technology.”

Students have an opportunity to think about how technological advances have enabled the understanding of DNA sequences to move forward. As understanding advances, new technologies are developed that make use of new knowledge to solve human and societal problems, such as the study of genetic diseases and the development of interventions to curtail resulting medical problems.

Content Standard F - Science in Personal and Social Perspectives
“All students should develop an understanding of personal and community health and of population growth.”

The webquest allows students to think more deeply about how DNA sequences can affect their own personal health, public health issues and disease prevention.

Content Standard G – History and Nature of Science
“All students should develop understanding of science as a human endeavor and of the nature of scientific knowledge.”

Throughout the webquest, students see the many ways in which technology and science each drive the other forward in a leapfrog manner. Students discuss the application of DNA sequence technologies, share their interpretations, pose questions, and debate the significance and implications of new knowledge. Students deliberate on why the general public may need a better understanding of DNA sequences and how that knowledge may empower then to be more proactive with respect to health issues and genetic testing.

Evaluations

Evaluations

Download the Evaluation Rubric (Adobe PDF).

Alternate Activities

Alternate Activities

There are several activities that can also be used to extend the webquest:

1) Find the mutation. Print out the following pdf (2 pages) on overhead transparencies. The DNA sequences have one base change. If the pages are examined side-by-side, it is very hard to identify the mutation. However, it is easy to detect by overlaying the two overheads. This would be a great starting point for a discussion on how modern computing has enabled the genomic revolution.

CF Mutations Overhead pdf.

2) Perform your own DNA extractions. Students can collect cells by scraping the inside of their cheeks with a tongue depressor or swishing water in their mouths DNA will be precipitated by treatments with a soap and salt solution and isopropyl alcohol.

3) Create your own family tree. Several web sites provide instructions for producing a family tree that shows genetic traits.

http://www.hhs.gov/familyhistory/

This could be a springboard to discuss other kinds of genetic diseases, as well as how certain genes may make individuals susceptible to diseases. This could lead to a discussion about how environment and personal choices affect health.

4) Take an inventory of genetic traits (tongue rolling, widow’s peak, etc.) and compare to other classmates.

Genetic Traits presentation
Genetic Traits worksheet
Genetic Traits worksheet key

This WebQuest would be easily adaptable to the Jigsaw technique, a cooperative learning technique that reduces racial conflict among school children, promotes better learning, improves student motivation, and increases enjoyment of the learning experience. See www.jigsaw.org for instructions for this technique.

Students also could be given a list of different genetic diseases to research according to their roles (no bioinformatics with this option). A good resource is www.ygyh.org. This site has a list of well characterized diseases.