Search

Genetic Disease Webquest

Introduction

Introduction and Task

You are members of an elite medical investigation team, called into action because of a high number of mysterious infant deaths in a remote community in New Mexico. It is unclear whether the deaths are a result of an infectious disease or an inherited gene.. As part of your investigation, your tasks are to determine the cause of these deaths and what can be done to save the lives of other children in this community.

The preliminary investigation revealed that all of the afflicted infants had two copies of the DNA sequence shown below. In addition, the parents of the infants all mentioned that the children had sweat that seemed to be saltier than normal. It is your task to discover the significance of this DNA sequence, determine how it relates to those with the disease, and describe its symptoms and possible treatments. You will then prepare a report to inform public officials of the outcome of your investigation.

TGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCT
GTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATTGGTGTTTCCTATGA
TGAATATAGATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTG
CAGAGAAAGACAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCA
AGAATTTCTTTAGCAAGAGCAGTATA

For this project you will break into groups of four Each team will use the Koshland Science Museum website as a resource to investigate DNA technology and perform a computational analysis of the DNA sequence that was found in the sick infants.. Using the attached worksheet as a guide, work as a group to complete the following tasks

Group Activity

Group Activity

Do these tasks as a group and complete the Group Worksheet.

1) Learn about DNA technology in the Introduction and Criminology sections of the website. What kind of biological samples could have been used to collect the DNA from the sick infants? How similar is human DNA to that of other species?
Read the Introduction to the Putting DNA to Work exhibit
Read about DNA evidence in the Putting DNA to Work exhibit

2) Go through the DNA Sequence portion of the website. Pay particular attention to the Probe the Sequence activity. What is the relationship between the size of the probe and the amount of times it occurs in the sequence?
Sequence information in the Putting DNA to Work exhibit

3) In the Probe the Sequence activity, you searched a fairly small stretch of DNA (about 1500 bases) for three or six base combinations. This is called a blast search. Now you are going to blast the DNA sequence from the sick infants against the entire human genome, which contains 3 billion base pairs -- just as scientists must when they investigate. The blast search compares the DNA sequence from the sick children below, to all known DNA sequences in the human genome.

TGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTT
CTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATTGGTGTTTCCTATGATGAATA
TAGATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAG
ACAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTCTTTAG
CAAGAGCAGTATA

Go to the DNA blast search at the National Center for Biotechnology Information website.

Copy and paste the DNA sequence for the sick children into the box with the title: “Enter an accession, gi, or a sequence in FASTA format:” and press the “Begin Search” button at the bottom of the page. You will be directed to another page, where you should press the “View Report” button.

After a few seconds, you will get several “hits.” Scroll down to the first result, “>ref|NT_007933.14|Hs7_8090,” and look at the comparison of the two DNA sequences. Your sequence is on the top row (Query) and the Blast result sequence (Subject) is underneath your sequence. How does your sequence compare to the known sequence? A vertical line between the two sequences indicates that they are identically matched. If no vertical line appears, it indicates that the sequence you entered has s a mistake, or a mutation. . What is missing from your sequence that is in the known sequence?

***Print out ONLY THE FIRST 2 PAGES and turn in with group report***

• Copy the blue text under “Features in this part of subject sequence” that gives the name of the gene (only up to the comma). Open the site below, paste the gene name into the white box, and press the “Go” button.

http://www.ncbi.nlm.nih.gov/omim

***Print out ONLY THE FIRST PAGE and turn in with group report***

Click on the first link (*602421) to find out more about the gene and what disease it causes.

• Discover how the DNA sequence relates to the disease.

Click on the first link (*602421): this will tell you more about the gene and what disease it causes.

• Learn more about how the DNA sequence relates to the disease.

http://www.ygyh.org/cf/cause.htm

4) Learn more about inherited diseases at the Marian Koshland Science Museum.

Inherited Disease information in Putting DNA to Work exhibit

Give an example of an inherited disease and what kind of mutation causes it.

 

Individual Roles

Individual Roles

Process

Now that you have matched the DNA sequence to a specific disease, your medical investigation team will need to do more research.. Each member your group should now take on a role: DNA Scientist, Epidemiologist, Disease Specialist, or Genetic Counselor. Work individually according to your role to investigate the cause of the illness. When you are finished with your individual research, you will share what you have learned with your group and prepare a report to be presented to local officials.

The Roles
DNA Scientist (Ph.D. Biologist): Investigate the structure of DNA and how it codes for proteins.
Epidemiologist: Study the history of the disease, including when and how it was discovered, when the genetic basis was determined, how many people are affected and what the risk factors are.
Disease specialist (pediatrician): Learn about the disease, its symptom, and current treatment options.
Genetic Counselor: Explore how genetic counseling works, and use gengetics to analyze inheritance patterns in families with disease.

Summary Activity

Summary Activity (To turn in)

Individually complete and turn in the worksheet for your role.

As a group, prepare a report and/or a presentation answering the following questions:

1) What is the cause of this disease? Gene therapy is a possibility for future treatmente. Discuss the pros and cons of gene therapy.

2) What are the pros and cons of genetic testing for this disease? Who should be tested? Who should be able to access the results of a genetic test (patients, doctors, insurance companies, employers)?

3) Make recommendations for local officials detailing what you think their community policies should be regarding the prospect for future disease, treatments, counseling recommendations, etc.

Each question should be answered in a one page report (for a total of three pages). The report must be approved by all members of the group before being turned in. These questions might require further research into the issues. Start with the references you used for your individual work, and then move to references in theEach question should be answered in a one-page report (for a total of three pages). The report must be approved by all members of the group before being turned in. These questions might require further research into the issues. 

Conclusion

Congratulations! You have figured out the cause of infant deaths in this remote community. Now on to your next medical challenge.....